Replicore гепатит б

Replicore гепатит б

RNA-Seq Based Transcriptome Analysis of Hepatitis E Virus (HEV) and Hepatitis B Virus (HBV) Replicon Transfected Huh-7 Cells
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3914852/

Конкурирующие интересы: авторы заявили, что конкурирующих интересов не существует.

Задуманные и разработанные эксперименты: СКП. Выполнял эксперименты: NJ SPKV. Проанализированы данные: SPKV DT PJ NJ. Добавленные реагенты / материалы / инструменты анализа: HD SKP. Написал документ: SKP DT SPKV PJ.

Патогенез инфекции вируса гепатита B (HBV) и вируса гепатита E (HEV) столь же разнообразен, как кажется; в то время как HBV вызывает острую и / или хроническую болезнь печени и гепатоцеллюлярную карциному, HEV в основном вызывает острое самоограничивающее заболевание. В обеих инфекциях ответы хозяев имеют решающее значение при установлении заболевания и / или в разрешении вируса. Вследствие обострения прогноза, описанного во время суперинфекции HEV при хроническом гепатите HBV, мы исследовали реакции хозяина путем изучения изменений экспрессии генов в клетках печени (линия клеток Huh-7) путем трансфекции только с помощью репликона HEV (только HEV) Только HBV-репликон (только HBV) и как HBV, так и HEV-репликоны (HBV + HEV). Репликация вируса была проверена с помощью специфичной для конкретной линии RT-PCR в реальном времени для HEV и HBsAg ELISA культуральных супернатантов для HBV. Косвенная иммунофлуоресценция для соответствующих вирусных белков подтвердила инфекцию. Профилирование транскрипции проводили с помощью анализа РНК-секвенирования (РНК-Seq) обогащенной поли-A РНК из трансфицированных клеток. В каждом образце были секвенированы средние из 600 миллионов баз в пределах 5,6 млн. Считываний, а ~ 15500 генов были отображены с хотя бы одним или несколькими показаниями. В общей сложности 461 ген в HBV + HEV, 408 только в HBV и 306 только в группах HEV были дифференциально выражены по сравнению с контролем ложной трансфекции двумя сгибами (p

Вирус гепатита Е (HEV) представляет собой небольшой 27-34 нм, без оболочки, одноцепочечный, с положительным чувством, содержащий 7,7 кб РНК, который попадает в организм хозяина в основном через пероральный путь [1]. Вирус гепатита B (HBV) представляет собой парентерально переданный 40-45 нм, окутанный, частично двухцепочечный циркулярный 3,2 kb ДНК, содержащий вирус [2]. Инфекция HBV широко распространена и включает в себя более 350 миллионов человек во всем мире [3] и является основной причиной хронического гепатита. Значительная часть этих хронически инфицированных людей находится в районах, эндемичных для инфекции HEV.

Вирус гепатита Е стал глобальным патогеном, влияющим на пищевую цепь [4], и, помимо возникновения эпидемий и высокой смертности во время беременности [5], он недавно был связан с хроничностью у реципиентов твердых органов и пациентов с ослабленным иммунитетом [6]. Было также описано, что HEV вызывает суперинфекцию у пациентов с хроническим заболеванием, связанным с HBV [7], [8], [9], [10], [11], [12], [13], [14], [ 15], что составляет 20% случаев в регионах, эндемичных для HEV [13]. Причина быстрой декомпенсации в суперинфекции HEV при хронической инфекции HBV не понята. Оба вируса должны быть нецитопатическими. Таким образом, изменение исходных реакций клеток-хозяев и впоследствии приобретенные защитные механизмы против вирусной инфекции могут играть важную роль. В этом отношении необходимо детальное понимание патобиологии сверхинфекции HEV.

Свидетельство указывает на участие клеточно-опосредованных иммунных ответов в патогенезе как инфекции HEV, так и HBV [16], [17]. Однако взаимодействие хозяин-патоген инициируется задолго до того, как наступит приобретенный защитный механизм. Поэтому важно понять исходные ответы хозяев, которые могут изменить исход инфекции. Чтобы лучше понять непосредственные изменения, происходящие после заражения, в отсутствие модификаторов внешнего ответа, присутствующих in vivo, и обхода количественных ограничений, присутствующих в протеомических инструментах, мы исследовали реакции хозяина, вызванные репликоном HEV, когда трансфицировали в одиночку и при трансфекции в HBV-инфицированные клетки Huh-7, созданные с помощью трансфекции репликона HBV 1.3mer. Мы использовали анализ транскриптомы на основе РНК-последовательности (РНК-Seq) и проверку относительной экспрессии генов на основе ПЦР в реальном времени на клетках, трансфицированных только с помощью HEV-only (HEV), HBV-only (HBV) и HBV + HEV-репликонов. Анализ дифференциальной экспрессии генов выявил несколько врожденных иммунных реакций, трансдукцию сигнала, выживаемость клеток и связанные с метаболизмом гены. Обсуждается значимость этой измененной экспрессии генов в вероятном исходе как инфекции HEV, так и ее суперинфекции на HBV.

Полноразмерная и полиаденилированная геномная РНК HEV была получена путем транскрипции in vitro из полноразмерного клона кДНК HEV pSGHEV-HB (FJ457024) (генотип 1) [1], используя mMessage mMachine T7 ultra kit (Life Technologies, США), как описано ранее [1]. Восстановленную РНК количественно определяли с использованием спектрофотометра Nanodrop (Thermo Scientific, США) и хранили при -80 ° C до дальнейшего использования. Репликон генотипа-А-репликатора HERV с избыточным размером 1.3m в нулевом векторе pcDNA3 был построен из pRLnull (77-1246) WTSPGE и pRLnullΔCMVWT1.86mer (рисунок S1). ДНК pcDNA3ΔCMVHBVWT-1.3mer (HBV1.3mer) и pcDNA3-нуль-векторную ДНК (используемую для ложной трансфекции в настоящем исследовании) готовили с использованием набора Plasmid Mini (Qiagen, Германия) в соответствии с инструкциями производителя. Восстановленную ДНК количественно определяли с использованием спектрофотометра Nanodrop и хранили при -20 ° C до дальнейшего использования.

Линия клеток гепатомы человека (Huh-7) поддерживалась в модифицированной среде Дульбе (Eagle’s Medium, DMEM) (Invitrogen, США), дополненной 10% инактивированной теплом фетальной бычьей сывороткой (Invitrogen, США) и 1X Antibiotic-Antimycotic (Sigma-Aldrich, США ). Клетки поддерживали в атмосфере 5% СО2 при 37 ° С. Конфлюэнтные монослои клеток Huh-7 поддерживали в культуральных колбах 75 см2 (Corning, США), трипсинизировали и пассировали. Подсчет клеток проводили с использованием камеры Нойбауэра (Мариенфельд, Германия). Клетки (1,8 × 107) брали и обрабатывали в двух партиях 9 × 106 клеток. Клетки гранулировали и дважды промывали средой для трансфекции (без сыворотки 1X DMEM, полученной в свободной от нуклеазы воде). Клетки окончательно ресуспендировали в 0,5 мл трансфекционной среде и добавляли 9 мкг pcDNA3HBV-1,3mer в одной партии клеток и в другой партии, только контроль вектора, добавляли 9 мкг pcDNA3-нуль. Затем две суспензии брали в отдельные кюветы Gene Pulser® (электрод 0,4 см) (Bio-Rad, США) и инкубировали при 4 ° C в течение 10 минут с последующим коротким импульсом при 200 В, емкостью 975 мкФ в Gene Pulser® II электропоратор (Bio-Rad, США). После импульса клетки в кювете повторно суспендировали в полной среде и разбавляли. Количество клеток было получено с использованием Trypan Blue (Sigma, США) для оценки степени гибели клеток. Клеточные суспензии высевали одинаково на пять 60-миллиметровых пластин (Corning, США) для каждой партии. Клетки в каждой пластине наносили на 2 мл среды и инкубировали, как описано выше.

Среда была изменена через 6 часов после электропорации, чтобы удалить мертвые клетки. Отработанную среду в течение всего эксперимента через каждые 24 часа фильтровали с использованием фильтра 0,2 мкм и хранили при -80 ° C для обнаружения HBsAg с помощью ELISA. Спустя 48 часов после электропорации пластины обрабатывали для трансфекции РНК HEV, как описано ранее [18]. HV-РНК-липосомальные комплексы проводили путем инкубации 4 мкг РНК HEV с реактивом Lipofectamine LTX и реагентом Plus Reactent (Invitrogen, USA) 1: 2,5 и 1:1 соответственно в течение 20 минут. Монослои трижды промывали трансфекционной средой, а РНК-липосомальные комплексы наносили на клетки. Две пластины обеих партий были издевательски трансфицированы только липосомами, в дальнейшем называемыми только HBV (только для pcDNA3ΔCMVHBVWT-1,3mer только электропорированных клеток) и pcDNA3-only (для pcDNA3-нулевого вектора только электропориентированные клетки). Остальные пластинки в двух партиях были названы HBV + HEV (для pcDNA3ΔCMVHBVWT-1.3mer электропорированных и HEV трансфецированных клеток) и HEV-only (для pcDNA3-нулевых электропорированных и HEV трансфецированных клеток). Трансфекционную среду во всех пластинах изменяли через 4 ч после трансфекции полной средой. Планшеты инкубировали в течение 24 ч и клетки собирали путем удаления среды. Монослой промывали PBS с последующим добавлением 1 мл реагента Trizol (Invitrogen, США) к каждой пластине и общей РНК, выделенной в соответствии с указаниями производителя. Гранулы РНК восстанавливали в свободной от нуклеазы воде и количественно определяли с использованием Qubit (Invitrogen, США) и хранили при -80 ° C до дальнейшего использования.

Отфильтрованные культуральные супернатанты, собранные во время экспериментов, как описано выше, анализировали с помощью набора Monolisa HBsAg Ultra (Bio-Rad, США) для определения HBsAg согласно инструкциям производителя и детектировали с помощью считывателя ELISA (Tecan, Switzerland). Репликативно-промежуточная, а также геномная положительная цепь HEV были обнаружены из 500 нг общей РНК, выделенной из каждой пластинки с помощью специфичной обратной транскрипции с последующей цепью с последующей ПЦР в реальном времени [1]. Прямородную обратную транскрипцию достигали с использованием антисмыслового праймера 5187-5168 RP (5 ‘AAAAACATGAGGAACAGCAG 3’) для обнаружения геномной цепи и смыслового праймера 5007-5026 FP (5’GATTGGCATGCTACAGGCTG 3 ‘) для обнаружения отрицательных цепей в сочетании с Обратная транскриптаза M-MLV (Invitrogen, США). Пару Primer 5007-5026 FP и 5187-5168 RP использовали для ПЦР-амплификации в реальном времени 5 мкл кДНК в комбинации с основной смесью SsoFast EvaGreen (Bio-Rad, США) на машине реального времени CFX96 (Bio-Rad, США) , Для ПЦР в реальном времени использовался следующий профиль температуры: начальная денатурация 98 ° С в течение 5 мин; 40 циклов 95 ° С в течение 30 с, 60 ° С в течение 30 с, 72 ° С в течение 30 с (с считыванием пластины) с последующей кривой расплава по умолчанию. Кроме того, эффективность репликации обоих вирусов была продемонстрирована методом иммунофлюоресценции [1]. Клетки фиксировали (4% параформальдегида в течение 10 мин при комнатной температуре), пермеабилизировали (3 мин в предварительно охлажденном метаноле при комнатной температуре) и блокировали 1% BSA (бычий сывороточный альбумин) (Sigma-Aldrich, США) в PBST (0,05% tween -20 в забуференном фосфатом физиологическом растворе) в течение 1 часа, затем 5% козьей сыворотки (Abcam, США) в течение 2 часов. Кроме того, клетки окрашивали поликлональным кроличьим анти-HBsAg (AbD Serotec, США) и моноклональными мышиными анти-HEVpORF2 [19] первичными антителами с последующим окрашиванием вторичным антителом козьим антикроликом Alexa 546 и козой антимышиной Alexa 488 (Invitrogen, США), соответственно. Клетки окончательно контрастировали с использованием DAPI и отображали на инвертированном флуоресцентном микроскопе TE-2000 U (Nikon, USA).

мРНК очищали от общей РНК с использованием прямого микроната Dynabeads mRNA (Life technologies, США) в соответствии с указаниями производителя. До начала протокола каждый образец был заполнен контрольными контрольными контурами внешнего управления РНК (ERCC) (Life technologies, США), пропорциональными количеству общей РНК в каждом образце. Очищенную мРНК количественно определяли в Qubit, и целостность мРНК проверяли с использованием Bioanalyzer 2100 (Agilent, США) с использованием чипа и набора RICS6000 pico согласно инструкциям производителя. Очищенные и охарактеризованные образцы мРНК хранили при -80 ° С до дальнейшего использования.

Подготовка библиотеки для РНК-Seq включала в себя четыре стадии, включая фрагментацию, адаптацию адаптера, синтез кДНК и амплификацию кДНК. Все этапы были достигнуты с использованием Ion-PGM RNA-Seq kit v2 (Life technologies, США) в соответствии с инструкциями производителя. В качестве входных данных всех образцов использовали равное количество мРНК (150 мкг). Усиленная кДНК была количественно определена в Qubit, и ее профиль проверял распределение по размерам и концентрацию пиков на Bioanalyzer 2100. Готовые библиотеки хранили при -20 ° C до дальнейшего использования.

Библиотеки с амплифицированными фрагментами кДНК дополнительно клонировали путем эмульсионной ПЦР на частицах ионной сферы (ISP) с использованием набора 200-шаблонов Ion One Touch 200 (Life technologies, США) в Ion One Touch v1 (Life technologies, США) в соответствии с инструкциями производителя. Опубликованная ПЦР шаблон положительных интернет-провайдеров был восстановлен и был обогащен для удаления нестандартных ISP на Ion One Touch ES (Life technologies, США). Обогащенный ISP был восстановлен и обработан для секвенирования с использованием набора для секвенирования Ion PGM 200 в соответствии с инструкциями производителя. Наконец, ISP были загружены на чип 318 и упорядочены на Ion torrent-PGM (Life technologies, США), используя параметры по умолчанию (одностороннее, прямое секвенирование). Последовательности были загружены в NCBI-Short Read Archive (SRA) в Bioproject PRJNA222881.

Последовательная последовательность вызова и обрезка адаптера выполнялась в Torrent Suite версии 3.6 (Life technologies, USA). Выводные выходы были выровнены и отображены с использованием программного обеспечения Partek Flow (flow_base v2.2 и flow_rna_seq v1.0) (Partek, США). Исходные чтения сначала подвергались предварительному выравниванию. Контроль качества и контроль качества (QAQC) и контроль качества ERCC (с использованием выравнивателя TMAP). Любая база ниже значения Предела 17 была обрезана с обеих сторон считываний и считалась длиной менее 20 нт. Обработанные чтения были выровнены двухэтапным протоколом к ​​эталонному геном hg19, сначала используя Tophat2 (параметры по умолчанию), а затем Bowtie2 для оставшихся невыровненных чтений с предпочтением, установленным на «очень чувствительный локальный». Выровненные показания с обоих выравнивателей были объединены, а качество и охват отображения были проверены посредством QAQC после выравнивания. Выделенные чтения были сопоставлены с транскриптами RefSeq (2013-01-04) (анализ РНК-Seq: Partek E / M).

Отображаемые отображаемые данные анализировали на дифференциальную экспрессию генов в Partek Genomic Suite v6.6 (PGS, Partek, USA). Гены были отфильтрованы по трем категориям в зависимости от количества считываемых изображений, которые были отображены на ген, как низкие (от 1 до 5), средние (от 5 до 10) и высокие (> 10 прочтений). Показания генов были нормализованы с помощью считывания, отображаемого на килограммовую базовую длину транскрипта на миллион считываний (RPKM) и преобразование лога. Регистрированные значения RPKM для генов были использованы для получения дифференциального выражения Anova. Списки Anova для каждого сравнения: HEV vs pcDNA3, HBV vs pcDNA3 и HBV + HEV vs pcDNA3 были использованы для получения генов с более чем +/- 2-кратным изменением экспрессии и значения p

Четыре микрограмма полной РНК из каждой трансфекции, т.е. только pcDNA3, только HBV, только HEV, HBV + HEV использовали для обратной транскрипции с использованием 2,5 мкМ олиго-dT (18) (Thermoscientific, USA) в 25 мкл-реакции, содержащей 200 U-суперстриксом III (Invitrogen, USA), DTT 5 мМ (Invitrogen, США), MgCl2 1 мМ (ABI, США), dNTP 200 мкМ (ABI, США) 1X RT-буфер (Invitrogen, США) и RNaseOUT 1 U (Invitrogen , США). Обратная транскрипция проводилась в ABI 2720 Thermocycler (ABI, США) с тепловой крышкой в ​​течение 50 мин при 42 ° С и затем инактивацией при 85 ° С в течение 5 мин. 5 мкл кДНК-продукта использовали для амплификации в 20 мкл-реакции, содержащей 300 нМ каждого прямого и обратного праймеров (табл. 1), и 1X концентрации основной смеси SsoFast EvaGreen (Bio-Rad, USA). Реакцию проводили на машине PCR реального времени CFX96 (Bio-Rad, США) со следующими условиями циклирования: начальная денатурация 98 ° C в течение 2 мин; 40 циклов при 95 ° С в течение 30 с, 55 ° С в течение 30 с (с считыванием пластины) с последующей кривой расплава по умолчанию. Все гены изучались в трех повторах, а анализ пост-считывания относительной экспрессии генов выполнялся на программном обеспечении Bio-Rad CFX. Глицеральдегид-3-фосфатдегидрогеназу (GAPDH) использовали в качестве контрольного гена (контроль дома) и pcDNA3 в качестве контроля. Нормированные значения изменения смены для каждого гена были представлены на гистограмме.

Более ранние исследования сыворотки пациентов, совместно инфицированных HEV и HBV, либо описали увеличение количества копий генома HBV [14], либо не изменили количество копий в ходе исследования [15]. В нашем клиническом исследовании значительная вариация количества копий HBV не наблюдалась при коинфекции по сравнению с индивидуумами, инфицированными только HBV (рис. S2A), аналогичными выводам Marion-Audibert et al (2010) [15]. Однако число копий HEV у пациентов с двойной инфекцией было значительно выше, чем у людей, инфицированных только HEV (p = 0,007) (рисунок S2B). [Они были проанализированы у пациентов с двойной инфекцией HBV и HEV (n = 26, таблица S1) по сравнению с пациентами только с HBV (n = 19, таблица S2) или только с инфекцией HEV (n = 16, таблица S3). Анализ сывороточной вирусной нагрузки для этих ретроспективных материалов и двойного иммунофлуоресцентного окрашивания ретроспективных формалиновых фиксированных парафиновых биопсий печени (таблица S4 и рисунок S3) проводили на материале, хранящемся в Отделе патологии Всеиндийского института медицинских наук. Необходимое согласие и разрешение на это исследование (№ IEC / NP-206/2010) было получено от Комитета по институциональному этическому анализу для исследований по человеческим предметам. Пациенты были проинформированы и получили свое согласие на характер тестов, которые будут проводиться на их образцах. Образцы крови собирали с помощью стандартной венопункции и вакцинирующего средства, используя стерильную методику, тогда как биопсия проводилась с помощью стандартного иглообразного / транс-яремного метода menghini после согласия. Эта информация использовалась для целей диагностики и лечения]. В системе клеточной культуры с двойной трансфекцией, которая не обладает посторонними факторами (медиаторами воспаления, клетками происхождения хозяина и т. Д.), В числе копий обоих вирусов не наблюдалось никаких изменений (рис. S2C и S2D).

Эти предварительные данные предполагали, что реакции хозяина, вероятно, были связаны с быстрой декомпенсацией заболевания печени, а не с взаимодействием между вирусами как таковыми. Кроме того, мы исследовали биопсии у пациентов с двойной инфекцией и наблюдали, что большинство инфицированных клеток окрашивают положительно как для HBsAg, так и для HEV pORF2 (фиг. S3M-S3P) (таблица S4). Эти наблюдения привели нас к созданию системы двойного репликона-трансфекции для оценки изменений в машинах-хозяевах в присутствии обоих вирусов. Двойные и единичные трансфицированные культуры окрашивали антигенами HBV и HEV с помощью косвенной иммунофлюоресценции для проверки наличия инфекции. Большинство трансфицированных клеток, которые были положительными для HBsAg, также показали положительное окрашивание для HEV pORF2 в культурах с двойной трансфекцией (рисунок 1P). Окрашивание не наблюдалось для HBV и HEV в контроле за маточной трансфекцией, а только для трансфецированных культур только HEV и HBV (рис. 1D, 1H и 1L).

HBV (от I до L), HEV (от E до H) и HBV + HEV (от M до P), трансфецированные клетки Huh-7 окрашивали анти-HBsAg кроличьими поликлональными и анти-pORF2 мышиными моноклональными первичными антителами, а затем с Alexa 546 конъюгировали козьим анти-кроликом и Alexa 488 конъюгированными козьими антителами против мышиных вторичных антител в анализе косвенной иммунофлуоресценции. Ядра контрастировали с DAPI. Композитное изображение (P) показало как HBV, так и HEV-положительные клетки, а также только клетки HBV и только HEV. Композитные изображения H и L показывают положительность для HEV и HBV, соответственно. Мок-трансфицированный контроль не показал окрашивания ни для HBV, ни для HEV (от A до D).

Кроме того, репликация HBV и HEV в культурах трансфицированных клеток (HBV + HEV, а также только один трансфицированный только HBV / только HEV) была подтверждена с помощью ELISA HBsAg и обнаружения отрицательной цепочки с помощью специфичной в реальном времени ПЦР в реальном времени. Супернатанты из культур только HBV и HBV + HEV были положительными HBsAg (показание было в два раза выше, чем контроль только воды), в то время как супернатанты из искусственных культур трансфекции и культуры только для HEV были отрицательными (показание было похоже на контроль только воды). Прямая специфическая ПЦР в реальном времени для обнаружения отрицательной и положительной РНК HEV показала 0,93E + 09 и 2,5E + 09 копий на мл от трансфекции HEV и 1.07E + 09 и 2.28E + 09 копий на мл из клеток, трансфицированных HBV + HEV , соответственно.

Чтобы провести анализ дифференциальной экспрессии на основе РНК-Seq на уровне генов, необходима сильно обогащенная полиА-РНК. Общая РНК, выделенная из культур, дважды обогащалась для поли-А-РНК и удалялась рибосомальная РНК> 95-97%. Равномерное количество мРНК (150 нг) использовалось из всех образцов во время подготовки библиотеки. Библиотечная концентрация и распределение по размерам были одинаковыми по всем образцам со средней средней длиной фрагмента 193 п.о. (таблица 2). Во время секвенирования был достигнут средний процент загрузки 79%, с 97% -ными шаблонными положительными шариками (таблица 2). Наблюдалась 24-процентная поликлональность на платформе и протоколе (таблица 2). Из 5,6 млн. Читаемых книг из каждой выборки было сформировано 618 млн оснований данных о последовательности, средняя длина чтения 110 б.п. и средняя оценка качества Фреда 27,1 на чтение (таблица 2). В среднем за 1% низкого качества чтения были исключены во время базового вызова и обрезки адаптера, после чего анализы были проанализированы в Partek Flow (PF) и Partek Genomic Suite (PGS) (Партек, США). Предварительное выравнивание QAQC также включало анализ восстановленного пика ERCC в контроле после секвенирования. В среднем 59 из 92 транскриптов ERCC были отображены (> = 1 счет) со средней корреляцией Пирсона 0,82 и R2 0,71 для выравнивания фактических концентраций транскриптов (таблица 3). Предварительное выравнивание QAQC также включало обрезку низкокачественных баз на обоих концах чтения. Выравнивание обрезанных чтений в среднем составляло 51,79% и 95,23% от Tophat2 и Bowtie2, причем высокий процент считываний был однозначно выровнен по отношению к эталонному геному (таблица 4 и таблица 5). Высокое качество сопоставления было достигнуто со средним показателем сопоставления 40,2 и 20,45 от вершин Tophat2 и Bowtie2 соответственно (Таблица 4 и Таблица 5). Затем выровненные чтения были отображены в ссылочные транскрипты и проанализированы для дифференциального выражения. Средние значения 15 800 генов были сопоставлены, по крайней мере, более одного раза. Было обнаружено, что дифференциальные Anova на логарифмически трансформированных генах значения RPKM между тестом и контролем (HBV vs pcDNA3, HEV vs pcDNA3 и HBV + HEV vs pcDNA3) 408, 306 и 461 были дифференцированы в +/- 2 раза с p-значением

Экспрессия дифференциального гена Anova для каждого сравнения: HEV vs pcDNA3, HBV vs pcDNA3 и HBV + HEV по сравнению с pcDNA3 приводила к генам (A) 306, (B) 408 и (C) 461 с более чем +/- 2 кратное изменение экспрессии (регулируемые гены отмечены синим цветом, а нижние регулируемые гены отмечены красным цветом) и p значение

Дифференцированные экспрессии генов в трех сравнительных группах обогащались на основе функции с использованием обогащения генных онтологий (GO) в PGS. Отсечение p-значения обогащения HEV> HBV (Рисунок 3). Показатель обогащения для биологических процессов был представлен высоко в группах HBV + HEV и HEV, тогда как он был относительно ниже в группе HBV (рисунок 3). Более высокое обогащение метаболических процессов и выживаемость клеток наблюдалось в группах HBV + HEV и HBV. Однако в HEV наблюдалось более высокое обогащение для ответа на функциональную категорию стимула (рис. 3). Три основные категории, основанные на функции, включали защиту и выживание хозяев, передачу сигналов, торговлю и обмен веществ. Значительная разница в количестве генов защиты организма и выживаемости среди трех групп (HBV + HEV = 57, HEV = 65 и HBV = 16 генов) (таблица 4, 5, 6 соответственно) (таблица S6).

Графические диаграммы XY представляют собой тип GO (A, B и C) и функции (D, E и F) по оси x относительно средних значений обогащения по оси Y. Типы GO включают биологический процесс, клеточный компонент и молекулярную функцию, представленные в красном, синем и зеленом цветах, соответственно. GO обогащение дифференцированных экспрессированных генов показало более высокое обогащение для группы HBV + HEV (C), за которой следуют HEV (A) и HBV (B).

Бары представляют количество генов в списке, присутствующих в каждой функциональной категории.

Бары представляют количество генов в списке, присутствующих в каждой функциональной категории.

Бары представляют количество генов в списке, присутствующих в каждой функциональной категории.

Важные гены, основанные на функции из трех основных категорий (таблица 6), были подтверждены для их дифференциального выражения с использованием относительной количественной оценки на основе ПЦР в реальном времени (рисунок 7). Было проанализировано в общей сложности 20 генов и их профили экспрессии генов RT-PCR в реальном времени по сравнению с данными РНК-seq этих генов (рисунок 8). Шестнадцать из 20 генов имели аналогичную структуру экспрессии по сравнению с данными RNA-seq (CARD9, ACDY5, PYDC2, DENND2C, PRKCG, MGAT3, IFIH1, MVP, PDCL3, SARM1, SUMO4, TGFB3, TLR7, IRF7, PCYT1B и XAF1) ( Рисунок 7 и 8). Расхождения были обнаружены для оставшихся 4 генов (CHUK, HK3, LCAT и OASL), которые были отрегулированы в анализе РНК-seq, но не показали дифференциального выражения или были отрегулированы в RT-PCR-анализе (рис. 7 и 8). Большинство генов показали сходные измененные профили экспрессии в RT-PCR в реальном времени, как это было отмечено в анализе РНК-seq.

Графики XY представляют собой нормированную логарифмическую экспрессию генов, полученных в ПЦР в реальном времени, по сравнению с контролем pcDNA3 (исходный уровень представляет собой экспрессию в контроле pcDNA3).

Графики XY представляют собой гены, выбранные для валидации ПЦР в реальном времени, и их изменения складки, полученные в анализе РНК-seq, по сравнению с контролем pcDNA3 в культурах HEV (A), HBV (B) и HBV + HEV (C). Каждый ген был представлен одним и тем же цветом на трех графиках.

Оба HEV и HBV не являются цитопатическими. Поэтому первая строка врожденного ответа хозяина определит характер, время и тип приобретенного иммунитета, которые должны быть вызваны. В нашем транскриптовом анализе клеток Huh-7, трансфицированных вирусными репликонами, мы не использовали живой вирус, там обход врожденного иммунитета против вирусных белков в вирионах. Поэтому наш анализ дифференцирует ответы только на репликонную нуклеиновую кислоту и стадии позже. Мы идентифицировали дифференциально экспрессируемые гены, которые вовлечены в врожденные иммунные процессы, включая сигнализацию распознавания образов (PRR), воспалительную реакцию, движение и взаимодействие иммунных клеток, представление антигена и апоптоз (рис. 9, 10 и 11). Некоторые из них могут быть связаны с вирусными белками, которые могли возникнуть во время репликации вируса.

Группы HEV-only и HBV + HEV показали повышенное состояние защиты и ответов на выживаемость по сравнению с группой только HBV (рис. 4, 5, 6, 7 и 8). Геном HEV реплицируется через репликативные промежуточные продукты dsRNA [1], которые, вероятно, будут распознаваться внутриклеточными PRR, такими как TLR3 или RLR [ретиноевая кислота-индуцибельный ген-I (RIG-I) и связанный с дифференцировкой меланомы ген 5 (MDA5). В группах HEV-only и HBV + HEV мы обнаружили, что IFIH1 / MDA5 подвергается высокой регуляции по сравнению с группой только HBV, предполагающей потенциальную роль этого гена в активации антивирусных реакций (рис. 7 и 8). При связывании лиганда MDA5 ассоциируется с митохондриальным противовирусным сигнальным белком (MAVS), который активирует регуляторные факторы интерферона: IRF3 и IRF7, которые дополнительно активируют транскрипцию IFN [20]. Компоненты основного белка хранилища (MVP) (индуцированного вирусом фактора хозяина, который усиливает экспрессию IRF7) RNA 1-3 хранилища и MVP также были отрегулированы (рис. 7 и 8).

Экспрессия гена SARM1 / MyD88-5 (Sterile Alpha и TIR Motif, содержащая 1 TLR) адаптера была значительно повышена в группах HEV-only и HBV + HEV по сравнению с группой только HBV (рис. 7 и 8) (таблица S5). SARM1 функционирует как отрицательный регулятор TRIF-зависимой сигнализации TLR и блокирует активацию MAPK [21]. Сообщалось об усилении SARM1 при заражении бунявирусом, приводящем к гибели нейронов, связанной с реакцией окислительного стресса и повреждением митохондрий [22]. Поэтому роль этого адаптера в сверхчувствительности HEV от хронической инфекции HBV требует дальнейшего изучения. Кроме того, эндосомальный рецептор TLR7 и VTRNA1-3 (компонент MVP) регулировали в группе с двойным и HEV-единственным, которые могли индуцировать активацию IRF7 и продукцию IFN типа I.

NOD-рецепторный переходный белок-рецептор, CARD9 регулировался во всех трех группах (рис. 7 и 8). CARD9 играет критическую роль в опосредованной NOD2 регуляции передачи сигналов NF-κB и MAP, приводящей к провоспалительным реакциям (таблица S5) [23], [24]. Изменение некоторых генов, приводящих к ингибированию или регуляции NF-κB, наблюдалось, как в случае CHUK (консервативная спиральная спиральная повсеместная киназа) / IKK1. CHUK / IKK1, который фосфорилирует ингибиторы NF-κB и деградирует их, что позволяет транслоцировать NF-κB в ядро, что приводит к иммунным реакциям, и защита от апоптоза была отрегулирована [25]. Однако в относительной количественной оценке RT-PCR в реальном времени была повышенная регуляция CHUK во всех трех группах (рисунок 7). Кроме того, PYDC2, отрицательный регулятор передачи сигналов NF-κB был понижен во всех трех группах, что благоприятствовало активации NF-κB (рис. 7, 8, 9, 10 и 11) [26]. Кроме того, известно, что PYDC2 нарушает взаимодействие между PYCARD и NLRP3, которые являются компонентами многобелковых комплексов, называемых воспалением, которые необходимы для активации провоспалительных каспаз, приводящих к созреванию цитокинов, таких как про-IL1-β [27].

Несколько генов, которые кодируют либо клеточные поверхностные рецепторы, либо секреторные факторы, участвующие в клеточной клеточной коммуникации и хемотаксисе, к месту заражения, регулируются в группе только HEV. Уровни RAETG1, клеточного поверхностного лиганда для рецептора KLRK1 на NK-клетках регулировали, что могло привести к цитотоксичности, опосредованной NK-клетками (рис. 9) [28]. PECAM1 (Молекула адгезии тромбоцитов / эндотелиальных клеток 1), необходимая для трансэндотелиальной миграции лейкоцитов [29], регулировалась как в группах HEV, так и в HBV + HEV (рис. 9 и 11). Сообщалось, что уровни сыворотки sPECAM-1 выше у пациентов с ALF и HCC [30]. CCL27, провоспалительный хемотаксический агент, который связывается с рецептором CCR10 и запускает опосредуемое T-клетками воспаление [31], регулируется (рис. 9), а также был выбран лиганд Selectin P (SELPLG), который является высокоаффинным встречным рецептором для селектинов, экспрессированных на миелоидные клетки и стимулированные Т-лимфоциты и играет критическую роль в торговле лейкоцитами во время воспаления [32].

Экспрессия гена нескольких рецепторов поверхности иммунной клетки была изменена при двойной инфекции (рисунок 11) (таблица S5). Онкоген вируса миелопролиферативного лейкоза (MPL), участвующий в регуляции образования хемокинов через каскад JAK-STAT в клеточной пролиферации [33], регулировался. Принимая во внимание, что NGFR — проапоптотический рецептор смерти и OLR1 (провоспалительный, прооксидативный, апоптозный рецептор-поглотитель) были отрегулированы. Другие гены, экспрессия которых была нарушена, включала SGPP1, участвовала в процессе биосинтеза сфинголипидов и функционировала в проапоптотических и провоспалительных путях (таблица S5) [34]; Intraflagellar Transport 20 (IFT20), который входит в состав комплекса, вовлеченного в торговлю белками из тела Гольджи, включая рециркуляцию компонентов иммунной сигнализации (таблица S5) [35], [36]; Двойная оксидаза (DUOXA2), NADPH-оксидаза, вызывает снижение пролиферации клеток блоком G1, апоптозом и деградацией ДНК [37]. Наконец, альфа-индуцибельный альфа-интерферон 27 (IFI27) играет роль в антивирусном ответе на вирусы с положительной цепью РНК и активируется активация активности эндопептидазы цистеина в апоптозе (таблица S5).

Трансформирующий фактор роста-β (TGF-β) является центральным регулятором при хроническом заболевании печени. Повреждения, вызванные повреждением печени, активируют TGF-β, усиливают разрушение гепатоцитов и опосредуют активацию фибробластов и печеночных звездчатых клеток [38]. В нашем анализе усиление фактора роста TGFB3 наблюдалось во всех трех группах (рис. 7) (таблица S5). В группе HBV + HEV, TNF и TNF-индуцибельном TNFSF15, многофункциональные провоспалительные и проапоптотические цитокины были понижены, что дополнительно указывало на противовоспалительную и провосприимчивую среду. Более того, цитокины / такие факторы, как EBI3 (компонент IL-27) и IL23A (компонент IL23), которые могли модулировать ответы Т-клеток, были отрегулированы (таблица S5). Несколько других иммунно-ассоциированных генов были отрегулированы, включая цитотоксин PRG2 (активатор NK-клеток), CLEC4F (индуцируемый лектин C-типа, участвующий в представлении альфа-галактозилмерамида к клеткам естественного киллера T (NKT) в печени) и хемокину CCL23 [39], [40].

Phosducin-Like 3 (PDCL3), также известный как вирусный IAP-ассоциированный фактор 1 (VIAF), функционирует при активации каспазы во время апоптоза и помогает в сгибании белков, необходимых для регуляции прогрессирования клеточного цикла, регулируется во всех трех группах (таблица S5 ) [41]. UFM1-специфическая пептидаза 2 (UFSP2), тиоловая протеаза, которая специфически обрабатывает C-конец модификатора ubiquitin-fold-1 (UFM1), чтобы конъюгировать его с белками-мишенями, такими как UFM1-UFBP1, который участвует в предотвращении индуцированного ЭК стрессом апоптоза регулируется только в группе HEV и HBV + HEV [42].

Напротив, экспрессия генов нескольких потенциальных мишеней, которые могли бы сыграть роль в апоптозе или выживаемости клеток, была понижена в группе HEV-only (ANKRD1, ATG14, CNKSR1, CDKL2, FASTKD1 и PDIA2) (рис. 9) (таблица S5). Коннектор Усилитель киназного супрессора Ras 1 (CNKSR1) необходим для активации Raf-1, который участвует в пролиферации, дифференцировке и апоптозе. Нарушение регуляции Raf приводит к апоптозу [43]. Семейство A, член 2 (PDIA2) белковой дисульфидной изомеразы представляет собой субстрат каспазы, расщепленный каспазой-3 и -7 во время апоптоза. Транскрипционный коактиватор ANKRD1, умеренно регулирующий активность р53, и его подавление может предотвратить апоптоз.

Паттерн изменения экспрессии генов в группе HBV + HEV отличался от группы только для HEV для генов-кандидатов, возможно, участвующих в апоптозе. Повышенные регулируемые гены включали связанный с XIAP фактор 1 (XAFI / BIRC4BP), который связывает и противодействует ингибирующему действию члена семейства белков IAP (ингибитор апоптоза) и, следовательно, способствует апоптозу. Аналогично, ген KLHL2 (кельхподобный член семейства) кодирует компонент комплекса Cub3-RING ubiquitin ligase, который может связывать актин. SARM1, помимо того, что является отрицательным регулятором сигнализации TLR, является проапоптотическим. Приеклин A3 (ANXA3) проапоптотичен в нейронных клетках, но регенерирует в гепатоцитах. N-Ацилсфингозин Амидогидролаза 2 (ASAH2) (не лизосомальная керамидаза), генерирует церамиды во время стрессовой стимуляции и является проапоптотической. Бакуловирующее повторение ИАП, содержащее 7 (BIRC7), член семейства ингибиторов протеинов апоптоза (IAP) и является антиапоптотическим (рис. 11) (таблица S5). Напротив, циклинзависимая киназа 7 (CDK7), которая функционирует как Cdk-активирующая киназа (CAK) и является важным регулятором прогрессирования клеточного цикла, была отрегулирована (таблица S5).

Недавнее исследование исследовало роль противовирусных реакций в клеточной линии A549 после инфицирования HEV и продемонстрировало визуальную чувствительность через рецепторы TLR2, TLR3 и TLR4, которые индуцировали MyD88 и TRIF-опосредованную активацию IRF3 и NF-κB, приводящую к провоспалительному ответу [44 ]. Ограничением этого исследования было инфицирование не гепатоцитарной клеточной линии, которое не могло указывать на естественный ход вирусного патогенеза. Кроме того, используемая клеточная линия дефектна в TLR7 и TLR8 генах, которые кодируют рецепторы, которые являются ключевыми датчиками генома вирусной ssRNA в эндосомальном отделении, где вирусный капсид не покрыт оболочкой [45].

Было показано, что в любой инфекции HBV или HEV несколько сигнальных молекул и факторы транскрипции изменяются, но сложность и перекрестная связь между этими потенциальными мишенями такова, что определенный путь ниже по течению, который может привести к гепатиту, еще не определен. В HEV большинство исследований, связанных с сигналами, проводили с использованием высокоэффективного ПОФФ3, экспрессированного in vitro
[46], [47], [48], [49], [50], где, как и во время вирусной инфекции, вирусные кодированные белки экспрессируются в значительно более низком количестве. Поскольку сигнальные пути приводят к плейотропным эффектам, результат чрезмерно выраженного вирусного белка, вероятно, будет отличаться от всего дополнения вирусных кодированных белков, которые могут действовать как синергически, так и антагонистически. В нашем анализе транскриптомы мы обнаружили изменение в экспрессии генов, вовлеченных в пути передачи сигнала, включая рецепторы, связанные с G-белками (GPCR), Ras GTPases, MAPK, NF-κB, Akt и несколько факторов транскрипции.

Подавление рецептуры GPR182 и последующей аденилатциклазы 5 (ADCY5) во всех трех группах может повлиять на сигнализацию путем модуляции уровней цАМФ (таблица S5). Более того, белковая тирозинфосфатаза, PTPRN2, отрицательный регулятор активности GTPase, регулируется, что может дополнительно блокировать путь cAMP (таблица S5). Кроме того, регуляторы Ras GTPases, ARHGAP22 (Rho GTPase-активирующий белок 2), DENND2C (домен DENN / MADD, содержащий активность фактора обмена 2C, Rab гуанил-нуклеотида) и MPP3 (мембранно-связанные гуанилат-киназные гомологи) были отрегулированы во всех трех групп (таблица S5). MPP3 является членом суперсемейства MAGUK, содержащим консервативный SH3-домен, который ассоциируется с цитоскелетом и играет важную роль в трансдукции сигнала, регуляции пролиферации клеток и внутриклеточных клеточных переходов.

В группе HBV + HEV наблюдалось очень сильное изменение экспрессии генов, участвующих в передаче сигнала. Несколько GPCR были отключены, включая GPR68, RHEBL1, MCHR1 и OPN1SW (таблица S5). GPR68 остро регулирует активность белков переноса транспорта эпителиальных протонов. RHEBL1, GTPase-активность регулирует каскад сигнализации TOR и позитивно регулирует транскрипционную активность NF-κB. MCHR1 (рецептор меланин-концентраторного гормона 1) представляет собой интегральный белок плазматической мембраны, который связывает концентрат, содержащий меланин, и может ингибировать накопление цАМФ и стимулировать внутриклеточный поток кальция. Нижестоящей мишенью цАМФ является протеинкиназа A (PKA), клеточная киназа, которая фосфорилирует сериновые и треониновые остатки. PPP1R16B (белковая фосфатаза 1, регуляторная субъединица 16B), ингибированный TGF-β белком, участвующим в PFA-опосредованном дефосфорилировании мозина и защитной оболочке эндотелиальных клеток, был отрегулирован (таблица S5) [51]. Регулятор цАМФ-мишени, Annexin A3 (ANXA3) относится к кальций-зависимому семейству фосфолипидов-связывающих белков и играет определенную роль в регуляции клеточного роста, который был отрегулирован (таблица S5). Этот белок функционирует при ингибировании фосфолипазы А2 и расщеплении 1,2-циклического фосфата инозита с образованием инозитол-1-фосфата. Напротив, член надсемейства Ras GTPase, FGD3 (FYVE, RhoGEF и домен PH, содержащий белок 3), вовлеченный в сигнализацию смерти клеток и регуляцию актинового цитоскелета, регулировался (таблица S5) [52].

Ras-связанный GTP-связывающий белок B (RRAGB), Ras-гомологичные GTPases представляют собой большое семейство сигнальных преобразователей, которые чередуются между активированным состоянием GTP-связывания и инактивированным состоянием, связанным с ВВП. Белок GRAP (связанный с GRB2 адаптерный белок), который связывает сигналы с сигнальным каналом Ras, был отрегулирован. Белоккиназа C (PRKCG) — семейство серин- и треонинспецифических протеинкиназ, которые могут быть активированы кальцием и второй мессенджером DAG, было отрегулировано. Кроме того, S100A1 (S100 кальцийсвязывающий белок A1), белок, участвующий в регуляции прогрессирования и дифференцировки клеточного цикла, также был понижен (таблица S5). Экспрессия генов молекул, участвующих в G-белковой связи сигналов обеих плеч, включая цАМФ и фосфатидилинозитольные пути, была отрегулирована (таблица S5).

TRIB1 (триблог-гомолог 1), который избирательно контролирует как степень, так и специфичность активации MAPK-киназы MAPK, был отрегулирован (таблица S5) [53]. В дополнение к фосфопротеину, регулируемому митогенными путями, TRIB1, по-видимому, играет ключевую роль в определении клеточной судьбы в ответ на экологический стресс. Экспрессия другого гена, который может влиять на каскад MAPK, была нарушена в нашем исследовании (таблица S5). N-ацилсфингозин-амидогидролаза (нелизосомальная керамидаза) 2 (ASAH2) катализирует гидролиз N-ацильной связи церамида с образованием сфингозина. Сфингозин является вторым мессенджером, который вызывает остановку роста клеток и действия, индуцирующие апоптоз, где, поскольку Сфингозин-1-фосфат (S1P), метаболит сфинголипида функционирует как внутри- и межклеточный второй мессенджер, способствует клеточной пролиферации и выживанию.

Мы обнаружили регуляцию малого ubiquitin-подобного модификатора 4 (SUMO4), который прикреплен к белкам и контролирует их субклеточную локализацию, стабильность или активность. SUMO4 специфически модифицирует IKBA (член семейства ингибиторов NF-κB) и отрицательно регулирует транскрипционную активность NF-κB и действует как регулятор обратной связи для предотвращения чрезмерной активации NF-κB [54].

Основное представление в метаболических процессах было связано с генами, связанными с метаболизмом липидов, ксенобиотиков и глюкозы. Малые группы включали протеогликан, метаболизм аминокислот и митохондриальные пути. В метаболизме глюкозы HK3 (гексокиназа 3) была равномерно распределена по трем группам вместе с двумя носителями растворения SLC2A2 (GLUT2) в HBV и SLC2A12 (GLUT8, 12) в HBV + HEV (таблица S5). Тем не менее, проверка RT-PCR в реальном времени показала повышенную регуляцию HK3 и LCAT во всех трех группах (рисунок 7). Расхождение, особенно в отношении генов, связанных с метаболизмом, может быть связано с различиями между культурами. В группе, содержащей только HEV, ESRRG (рецептор, связанный с эстрогеном), регулировали (таблица S5). Измененная экспрессия, наблюдаемая в генах, участвующих в метаболизме глюкозы, может привести к гипергликемии и непереносимости глюкозы во всех трех группах. Уравновешенные переносчики глюкозы GLUT2 и GLUT8, которые понижены, регулируются только HBV и HBV + HEV, соответственно, могут снизить способность поглощения глюкозы из крови. Урегулирование ESRRG (гамма-рецептор, связанное с эстрогеном) в HEV-only может стимулировать глюконеогенез, тем самым способствуя гипергликемии [55]. Напротив, несколько исследований с долгосрочным наблюдением не выявили повышенного риска / заболеваемости IGT / DM у этих пациентов [56], [57].

Несколько генов, участвующих в различных аспектах метаболизма липидов, показали изменение экспрессии во всех группах. Фосфат-цитидилтрансфераза 1, холин, бета (PCYT1B), фермент, необходимый для синтеза фосфатидилхолина, был значительно отрегулирован в группе HEV-only и HBV + HEV (таблица S5). Также фосфолипаза А2, которая катализирует гидролиз фосфатидилхолина до лизофосфатидилхолина, была отрегулирована в группе только HBV (таблица S5). Более ранние клинические исследования, документировавшие спектр фосфолипидов при гепатите В, были похожи на наши результаты, т. Е. Увеличивали уровень фосфатидилхолина и прогрессивно снижались уровни лизофосфатидилхолина [58], [59], [60]. Так как многие исследования на животных и несколько исследований в области человеческого тела показывают, что повышенное количество фосфатидилхолина выгодно для клетки-хозяина в различных болезненных состояниях, включая вирусный гепатит, это можно рассматривать как положительный ответ хозяина на вирусную инфекцию. Однако фосфатидилхолин, который является основным компонентом плазматических мембран, также необходим для репликации вируса и почкования.

Суточная регуляция двух генов ASAH2 (ацилфингозин-амидогидролаза / не лизосомальная керамидаза) и SGMS2 (сфингомиелинсинтаза2) может приводить к увеличению проапотитического церамида (таблица S5) [61]. Также наблюдалась низкая экспрессия SGMS2 для снижения поглощения жирных кислот и стеатоза в печени мыши [62]. Ацил-СоА-Синтетаза Средний член семейства 1-й цепи (ACSM1, с пониженной регуляцией) представляет собой лиганду CoA жирной кислоты, катализирующую активацию жирных кислот средней цепи для бета-окисления митохондрий (таблица S5). Его понижающее регулирование может способствовать стеатозу, однако, как два других члена этого семейства, то есть ACSM2 и ACSM3 показывают более высокие уровни экспрессии в гепатоцитах [63], значение этого изменения является неопределенным. Было обнаружено, что еще одна ацил-коА-синтетаза, ACSBG1 (член семейства пузырьков 1, также известная как липидозин), была отрегулирована в группе только HEV (таблица S5). Он опосредует активацию длинноцепочечных жирных кислот для синтеза клеточных липидов и деградации посредством бета-окисления и играет центральную роль в миелиногенезе. Это изменение может привести к накоплению LCFA и изменению клеточного липидного состава.

Экспрессия генов, участвующих в метаболизме гепарансульфата, была изменена в группе HBV + HEV. Усиление регуляции ARSG (арилсульфатазы G), лизосомального фермента, необходимого для завершения деградации гепарансульфата (таблица S5) и снижения регуляции HS3ST5 (гепарансульфата 3-O-сульфотрансферазы) фермента, который катализирует скорость, ограничивающую стадию биосинтеза гепарансульфата ( Таблица S5) предполагали снижение сульфата гепана в группе HBV + HEV. Учитывая, что различные исследования приписывали различные функции этому протеогликану при установлении многих вирусных инфекций, особенно HBV и HEV, важность этого изменения в патогенезе вирусного гепатита in vivo еще предстоит исследовать. Другими генами, участвующими в синтезе гликопротеина и гликозилированием белка, которые могут влиять на взаимодействие клеток и иммунных реакций, которые могут быть изменены, были B3GALT2 (галактозилтрансфераза), CASD1 (область капсульной структуры1, содержащая 1, кандидат млекопитающих сиалата-O-ацетилтрансферазы) ; как регулируемые в клетках, трансфицированных только HEV, так и MGAT3 (Mannosyl N-ацетилглюкозаминилтрансфераза), один из наиболее важных ферментов, участвующих в регуляции биосинтеза олигосахаридов гликопротеина, был отрегулирован в группе HBV + HEV (таблица S5).

В целом, экспрессия 13 генов (4 члена семейства UGT1, 4 семейства UGT2, 4 семейства цитохромов p-450 и NR1I3), участвующих в метаболизме ксенобиотиков, была изменена по трем группам, 8 из этих 13 были отрегулированы (таблица S5 ). Поскольку печень является основным местом метаболизма ксенобиотиков, такая подавление будет приводить к цитотоксическому повреждению, которое может быть вызвано вирусным гепатитом. В группе, содержащей только HBV, ген UGT1A7 регулировали (таблица S5). В нескольких исследованиях была зафиксирована связь между полиморфизмами этого гена, вызывающими низкую активность ферментов с началом ГЦК в раннем возрасте при вирусном гепатите. Помимо метаболизма ксенобиотиков эти ферменты также необходимы для конъюгации желчных кислот, метаболизма билирубина и стероидов. Поэтому подавление этих ферментов может иметь различные вредные последствия и, возможно, частично ответственное за гипербилирубинемию.

Острая инфекция HEV при хроническом заболевании HBV связана с быстрой декомпенсацией печени. Чтобы понять ответы хозяина на эти вирусы при двойной инфекции, мы установили модель клеточной культуры переходных клеток в клеточной линии Huh-7. Несмотря на то, что эта система не была эквивалентна острой инфекции HEV при хроническом заболевании HBV, это позволило нам понять исходные ответы инфицированных клеток печени. Мы исследовали картину экспрессии дифференциального гена клеток Huh-7 при трансфекции только HBV-only, HEV-only и как HBV, так и HEV-репликоны, используя секвенирование транскриптомы мРНК. Функциональный анализ показал, что большинство генов были вовлечены в реакции защиты организма и выживаемости, а затем на сигнальные и белковые модификации и метаболизм. Провоспалительные изменения генов были более преобладающими в группах HEV-only и HBV + HEV по сравнению с группой только HBV как в РНК-seq, так и в RT-PCR в реальном времени. Дальнейший скрининг и валидация нескольких новых и неизвестных генов из этого исследования обеспечит новое понимание понимания ответов хозяина и взаимодействий при коинфекциях HBV и HEV.

Построение репликона HBV. Блок-схема и схематическое представление стратегии клонирования для построения HBV1.3mer. Промотор CMV в pcDNA3 удаляли путем переваривания ферментами BglII и NotI и затем лигировали с BglII и NotI, высвобожденным фрагментом из вектора WTRPGE из pRLnull (77-1246). Лигированный вектор расщепляли BglII и EcoRV и восстанавливали на конце для самолигирования вектора, в результате чего получали HBV 0.3mer и представляли собой pcDNA3ΔCMVWTSPGE-0.3mer. Наконец, фрагмент SacII, представляющий 1.0mer от pRLnullΔCMVWT1.86mer, был лигирован с линеаризованным SacII pcDNA3ΔCMVWTSPGE-0.3mer с образованием pcDNA3ΔCMVHBVWT-1,3 mer.

(TIF)

Щелкните здесь для получения дополнительных данных.

Анализ количества копий вируса у пациентов и культура in vitro. Графики представляют собой средние числа копий журнала геномной ДНК HBV и геномной РНК HEV [образцы сыворотки пациентов (таблица S1, S2 и S3) в верхней панели и трансфицированные культуры Huh-7 в нижней панели]. (A) Количество копий HBV в двойной положительной сыворотке составляло 14,068 ± 3,07 на мл (таблица S1), а в HBV только положительная сыворотка составляла 13,52 ± 3,81 на мл (таблица S2) (p = 0,6) (t-тест). (B) Копии номеров HEV в двойной положительной сыворотке составляли 19,44 ± 5,19 на мл (таблица S1), а в HEV только положительная сыворотка составляла 15,85 ± 2,95 на мл (таблица S3) (p = 0,007) (t-тест). (C & D) Никаких существенных изменений не наблюдалось в количествах копий HBV и HEV при двойном (HBV + HEV) трансфецированном по сравнению с одиночными трансфецированными клетками.

(TIF)

Щелкните здесь для получения дополнительных данных.

Косвенная иммунофлуоресценция для выявления HBV и HEV в биопсии печени у пациентов с гиперинфекцией HEV при хронической инфекции HBV. Биопсии печени от инфицированных пациентов с HBV + HEV (от M до P), HBV (от I до L) и HEV (от E до H) (таблица S4) окрашивались анти-HBsAg кроличьими поликлональными и анти-pORF2 мышиными моноклональными первичными антителами, а затем Alexa 546 конъюгированных козьего кролика и Alexa 488 конъюгированных козьих антител против мышиных вторичных антител в косвенном иммунофлуоресцентном анализе. Ядра контрастировали с DAPI. В составном изображении (P) показаны как HBV, так и HEV-положительные клетки. Композитные изображения H и L показывают положительность для HEV и HBV, соответственно. Биопсия из нормальной печени (у пациентов с раком пищевода, удаленная от периферии во время операции) не окрашивала ни HBV, ни HEV (от A до D).

(TIF)

Щелкните здесь для получения дополнительных данных.

Хронические инфицированные HBV пациенты, коинфицированные острым гепатитом E.

(XLS)

Щелкните здесь для получения дополнительных данных.

Хронические инфицированные HBV пациенты.

(XLS)

Щелкните здесь для получения дополнительных данных.

Инфицированных пациентов.

(XLS)

Щелкните здесь для получения дополнительных данных.

Подробная информация о HBV, HEV и двойных инфицированных пациентах, биопсии печени которых были включены в исследование.

(XLS)

Щелкните здесь для получения дополнительных данных.

Списки генов с изменением смены и p-значениями групп HBV, HEV и HBV + HEV.

(XLS)

Щелкните здесь для получения дополнительных данных.

Списки функций гена, полученные из дифференциально экспрессированных генов в группах HBV, HEV и HBV + HEV после обогащения GO.

(XLS)

Щелкните здесь для получения дополнительных данных.

Мы хотели бы поблагодарить группу технической поддержки от Life Technologies и Partek за своевременную помощь в использовании программного обеспечения для анализа данных и обучения.



Источник: rupubmed.com

Читайте также
Вид:

Добавить комментарий